View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_161 (Length: 201)

Name: NF0547_low_161
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_161
NF0547_low_161
[»] chr4 (1 HSPs)
chr4 (7-172)||(28470981-28471146)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 7 - 172
Target Start/End: Complemental strand, 28471146 - 28470981
Alignment:
7 gttcttgcacattttcataaacttactcctgcgaaagcacggcagttacgagtgatactttgctctacttctctcaatgatcgttcgattgaggaacatt 106  Q
    ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
28471146 gttcttgcacattttcataaacttactcctgcgaaagcacgactgttacgagtgatactttgctctacttctctcaatgatcgttcggttgaggaacatt 28471047  T
107 tgctttgaatcaagaatcatgtagttgcgcttgcgcctgttggtgatccagttttctcgcaacagc 172  Q
    |||||||||||||||| | ||||||||||||||| |||||||||||||||||||| ||||||||||    
28471046 tgctttgaatcaagaaccgtgtagttgcgcttgcacctgttggtgatccagttttgtcgcaacagc 28470981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University