View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_21 (Length: 512)
Name: NF0547_low_21
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 3e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 173 - 361
Target Start/End: Original strand, 27404000 - 27404186
Alignment:
| Q |
173 |
caaaaatggtagttactaaatcacttctagttatgtgatattgttaaaatgatctctatccaatgtgtattgtttgtgtgatgtaaaactaagtaataac |
272 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27404000 |
caaaaatgctagttactaaatcacttctagtaatgtgat--tgttaaaatgatctctatccaatgtgtattgtttgtgtgatgtaaaactaagtaataac |
27404097 |
T |
|
| Q |
273 |
cacttatttcaggaaaagaagaaagaggaggcagaatttaaaatcagaaaagacgcttccgatgctatagaagaacatatcgatgatca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| | |||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
27404098 |
cacttatttcaggaaaagaagaaagaggaggcagaatttgaaatcgcagaagatgcttctgatactatagaagaacatatcgatgatca |
27404186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 45989475 - 45989514
Alignment:
| Q |
29 |
tggaagtgatcttaaggttcattttgttggtcattctcta |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45989475 |
tggaagtgatcttaaggttcattttgttggtcattctcta |
45989514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 308
Target Start/End: Original strand, 44927911 - 44927948
Alignment:
| Q |
271 |
accacttatttcaggaaaagaagaaagaggaggcagaa |
308 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
44927911 |
accacttatttcagaaaaagaagaaaaaggaggcagaa |
44927948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1275 times since January 2019
Visitors: 3667