View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_46 (Length: 412)
Name: NF0547_low_46
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 61 - 402
Target Start/End: Original strand, 53603190 - 53603531
Alignment:
| Q |
61 |
gttttttaattacatgtgatataattgttatccatccatattctaatttgcagcaagattatcactcaagcgtcaattgttgcgttcttcagcaaccttg |
160 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603190 |
gtttttcaattacatgtgatataattgttatccatccatattctaatttgcagcaagattatcactcaagcgtcaattgttgcgttcttcagcaaccttg |
53603289 |
T |
 |
| Q |
161 |
cagatgttggccttcatggttcaatgatggtattttatgattttcaagttttatcatgtattttttaaccttaacttagtttgtgatgccactctatttt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603290 |
cagatgttggccttcatggttcaatgatggtatgttatgattttcaagttttatcatgtattttttaaccttaacttagtttgtgatgccactctatttt |
53603389 |
T |
 |
| Q |
261 |
ttgtgtgcagtattacttaaaggctcggtttcattttgataagaatcactttgctgacttaatgatcatttctggtattgcagggactgtgtcacaggta |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603390 |
ttgtgtgcagtattacttaaaggctcggtttcattttgataagaatcactttgctgacttaatgatcatttctggtattgcagggactgtgtcacaggta |
53603489 |
T |
 |
| Q |
361 |
atttttgtaagaagtgattttagttgtcaaatatcacctatg |
402 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53603490 |
atttttgtaagacgtgattttagttgtcaaatatcacctatg |
53603531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University