View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_65 (Length: 357)
Name: NF0547_low_65
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 207
Target Start/End: Original strand, 21135163 - 21135340
Alignment:
| Q |
30 |
ctcatgacattataaaatttgcattgtttgaacttgttatgtagtgacttcctattgatcaagtgaacttgttatgtacttgactcttgcaatgttatga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21135163 |
ctcatgacattataaaatttgcattgtttgaacttgttatgtagtgacttcctattgatcaagtgaacttgttatgtacttgactcttgcaatgttatga |
21135262 |
T |
 |
| Q |
130 |
gcaaggatatgggcttcattgattcgggattgcagactgagcacaatgacttggggggccaaaatgatcatgattaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21135263 |
gcaaggatatgggcttcattgattcgggattgcagactgagcacaatgacttagggggccaaaatgatcatgattaaa |
21135340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 211 - 343
Target Start/End: Original strand, 21135595 - 21135727
Alignment:
| Q |
211 |
ttcaaattattattgacgtccccacaattattgtcaaacaaaatttcaaatagggttatcaataaaaatctcaattttatttcatcaaacagaaaattct |
310 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21135595 |
ttcaaattattattgaggtcccaacaattattgtcaaacaaaatttcaaatagggttatcaataaaaatctcaattttatttcatcaaacagaaaattct |
21135694 |
T |
 |
| Q |
311 |
tagctttatttgtacaaaaagaaaagtcagctt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21135695 |
tagctttatttgtacaaaaagaaaagtcagctt |
21135727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University