View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_68 (Length: 351)
Name: NF0547_low_68
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 29 - 210
Target Start/End: Original strand, 4067303 - 4067484
Alignment:
Q |
29 |
agggtttaagtaacaactcctcagaaaattcttcttctactacttttgccgaagacgatgatagaatcattgaaaaaaggagaatgaaagagagaatcgt |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4067303 |
agggtttaagtaacaactcctcagaaaattcttcttctactacttttgctgaagacgatgatagaatcattgaaaaaaggagaatgaaagagagaatcgt |
4067402 |
T |
 |
Q |
129 |
tgctggagcaaaagtcatcgttgcttgctaactttggaactctgctgtctgtttgagtagtggtgtgtacagactactaata |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
4067403 |
tgctggagcaaaagtcatcgttgcttgctaactttggaactctgctgtctgtttgagtagtggtgtgtacagactaataata |
4067484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 369 times since January 2019
Visitors: 3650