View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_68 (Length: 351)

Name: NF0547_low_68
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_68
NF0547_low_68
[»] chr8 (1 HSPs)
chr8 (29-210)||(4067303-4067484)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 29 - 210
Target Start/End: Original strand, 4067303 - 4067484
Alignment:
29 agggtttaagtaacaactcctcagaaaattcttcttctactacttttgccgaagacgatgatagaatcattgaaaaaaggagaatgaaagagagaatcgt 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
4067303 agggtttaagtaacaactcctcagaaaattcttcttctactacttttgctgaagacgatgatagaatcattgaaaaaaggagaatgaaagagagaatcgt 4067402  T
129 tgctggagcaaaagtcatcgttgcttgctaactttggaactctgctgtctgtttgagtagtggtgtgtacagactactaata 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
4067403 tgctggagcaaaagtcatcgttgcttgctaactttggaactctgctgtctgtttgagtagtggtgtgtacagactaataata 4067484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 369 times since January 2019
Visitors: 3650