View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_71 (Length: 339)
Name: NF0547_low_71
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 51216196 - 51215886
Alignment:
| Q |
1 |
aaactgtagactttcctctctctcactttggtagttgttgtcttcgtcttagtctttgtctt------cgatattgttttggacgaagacgcagacattg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
51216196 |
aaactgtagactttcctctctctcactttggtagttgttgtcttcgtcttcgtctttgtctttgtcttcgatattgttttggacgaagaagcagacattg |
51216097 |
T |
|
| Q |
95 |
tggttgttggttttgatttaacctatcaagtttatnnnnnnncaaaattgtaatcacaactaaactaacttatctaatctaactcgcaacaa----atat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
51216096 |
tggttgttggttttgatttaacctatcaagtttataaaaaaacaaaattgtaatcacaactaaactaacttatctaatctaacttgcaacaaatatatat |
51215997 |
T |
|
| Q |
191 |
caaccaacttgtaaccccctttaacaaacaattcaactaacattaattaatcaacacaattagagcaattatattatataacgaaaaaatacaagaaaaa |
290 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
51215996 |
caaccaactagtaaccccctttaacaaacaattcaactaac----attaatcaacacaattagacca-----attatataacgaaaaaataaaagaaaaa |
51215906 |
T |
|
| Q |
291 |
tgtaaaattaagaacaagat |
310 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51215905 |
tgtaaaattaagaacaagat |
51215886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 962 times since January 2019
Visitors: 3660