View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_76 (Length: 327)
Name: NF0547_low_76
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 80 - 270
Target Start/End: Original strand, 45616686 - 45616876
Alignment:
| Q |
80 |
ggtctaaggttatcacgttctaggaagtttttctctacaatgctcttttcaactagaattgtaagaatctacaatgatattgtgaacaaaattatgaaca |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616686 |
ggtctaaggttatcacgttctaggaagtttttctctacaatgctctattcaactagaattgtaagaatctacaatgatattgtgaacaaaattatgaaca |
45616785 |
T |
|
| Q |
180 |
tggaaaacagttatccagttattgttctacctactcaatggggtcttcctgttctgtctcacccctcagttgtttgcagaaggagtataat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
45616786 |
tggaaaacagttatccagttattgttctacctactcaatggggtcttcctgttctgtctcatccctcagttgtttgcagaaggagtgtaat |
45616876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 255 times since January 2019
Visitors: 3648