View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_80 (Length: 314)
Name: NF0547_low_80
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 30 - 270
Target Start/End: Complemental strand, 18428491 - 18428243
Alignment:
Q |
30 |
caagatttgttgagtaaatcatttgattagtctc--------agtagtcgagcagtttgattttcgaattaaagaaattttaaattagtttataaaatta |
121 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
18428491 |
caagatttgttgaataaatcatttgattagtcttgaaattgtagtagtcgagcagtttgattttcaaattaaagaaattttaaattagtttataaaatta |
18428392 |
T |
 |
Q |
122 |
aaatattcgatcaaataacatttttgatcggccaatttagtatttaaaattgtcttgtaaaccttatcagatcgaaaatttaaattttaagaaattattt |
221 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||| || ||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
T |
18428391 |
aaatattcgatcaaataatatttttgatcggccaatttagcatctaaaattttcttgtaaaccttgtcagatcgaaaatttaaatttcaagaaatcattt |
18428292 |
T |
 |
Q |
222 |
tagaattttgttaatttaaagggacgtctttaattgatattcctctctg |
270 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
18428291 |
tagaattttgttaatttgaagggacgtctttaattgatattcctctctg |
18428243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1184 times since January 2019
Visitors: 3665