View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_85 (Length: 307)
Name: NF0547_low_85
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 278
Target Start/End: Original strand, 36033849 - 36034116
Alignment:
Q |
13 |
cagcatacataacagccgaaatcgtgacaacc--aacgtgaccggctaaccgcaaccgttatttaaaacctttctatgacatgtaaatagtttagattga |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
36033849 |
cagcatacataacagccgaaatcgtgacaaccttaacgtgaccggctaaccgcaaccgttatttaaaaccttgctatgacatgtaaatagtttagattga |
36033948 |
T |
 |
Q |
111 |
ctaacattagcataagtagtccatttgaacgcagtctggacacaacttttcaatataatccatataaagtcatttgaagcaatgatatatcaactattgt |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36033949 |
ctaacattagcataagtagtccatttgaacgcagtctggacacaacttttcaatataatccatataaagtcatttgaagcaatgatatatcaactattgt |
36034048 |
T |
 |
Q |
211 |
tgatatatcactcgagcctcccaggggaacctaaacaccatcctccttctcactgctacctcccttta |
278 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36034049 |
tgatatgtcactcgagcctcccaggggaacctaaacaccatcctccttctcactgctacctcccttta |
36034116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 879 times since January 2019
Visitors: 3657