View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_86 (Length: 304)
Name: NF0547_low_86
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 50 - 261
Target Start/End: Original strand, 46483831 - 46484042
Alignment:
Q |
50 |
cattcaaccaatttaagattatcagaatctcattctcttgataatcgaagaattaagattaagaaagtttataatgaatcatagaattggaagaatagct |
149 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46483831 |
cattcaaccaatttaagattatcagaatctcattctcttgataatcggagaattaagattaagaaagtttataatgaatcatagaattggaagaatagct |
46483930 |
T |
 |
Q |
150 |
ttgatatttatggcgttgatgaatatctttgttcaaattgtacaactcgttctcaattcggatttagaaaagcatgaggttgttaagataaaccatcttt |
249 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
T |
46483931 |
ttgatatttatggcgttgatgaatatctttgttcaaattgtacaactcgttctcaattcggatttagaaaagcatggggttgtcaagataaaccatcttt |
46484030 |
T |
 |
Q |
250 |
agtcgtaccgcc |
261 |
Q |
|
|
|||||||||||| |
|
|
T |
46484031 |
agtcgtaccgcc |
46484042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 969 times since January 2019
Visitors: 3660