View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_89 (Length: 298)
Name: NF0547_low_89
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 12 - 270
Target Start/End: Original strand, 1034236 - 1034494
Alignment:
Q |
12 |
atgaacacaatttcaatttaactacactatagaacataatgattagttgtatgaatcttgtcgcactcatttatttttgggtaatataatgaacttatga |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
1034236 |
atgaacacaatttcaatttaactacactatagaatataatgattaattgtatgaatcttgtcgcactcatttatttttgggtaatataatgaactaatga |
1034335 |
T |
 |
Q |
112 |
attctgctcatactattatactaggatttcagttttcagcatgatactaattcacttgttcttgttttgctattataatgcaggtattaacaagatatac |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1034336 |
attctgctcatactattatactaggatttcagttttcagcatgatactaattcacttgttcttgttttgctattataatgcaggtattaacaagatatac |
1034435 |
T |
 |
Q |
212 |
tctggacaagttattcggccctagcgttggtcatgtgactagtgaccaaactattcttt |
270 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1034436 |
tctggacaagttattcggccctagcgttggtcatgtgactagtgaccaaactattcttt |
1034494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University