View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_96 (Length: 285)
Name: NF0547_low_96
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_96 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 91 - 240
Target Start/End: Complemental strand, 11561136 - 11560987
Alignment:
Q |
91 |
tgttgttgcagtcacttggatcatgttggagcattggcttacttcactgaagtttgtgggtatagtggaccggtttatatgacggtgggttgcctattac |
190 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
11561136 |
tgttggtgcagtcacttggatcatgttggagcattggcttacttcactgaagtttgtgggtatagtggaccggtttatatgacggtgggtcgcctattac |
11561037 |
T |
 |
Q |
191 |
ctgtttgatgaaatgtctaactcaatgtaatgctatgaacactctctttt |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11561036 |
ctgtttgatgaaatgtctaactcaatgtaatgctatgaacactctctttt |
11560987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 270
Target Start/End: Complemental strand, 11560970 - 11560931
Alignment:
Q |
231 |
actctcttttattcgatgaaatcaatataagacccaccat |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11560970 |
actctcttttattcgatgaaatcaatataagacccaccat |
11560931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University