View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_high_19 (Length: 251)
Name: NF0548_high_19
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 45654401 - 45654168
Alignment:
Q |
9 |
attcgaatgaatttagattaaagggatacatttccatgcaaggttcagtctcttttatgcttaactattgaattaggttggatgtttgatttgctaagca |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45654401 |
attcgaatgaatttagattaaagggatacatttccatgcaaggttcagtctcttttatgcttaactattgaattaggttggatgtttgatttgctaagca |
45654302 |
T |
 |
Q |
109 |
attggtgagtattacggtcttaaagttaaacccaagtaatcagtaattcaatgtcaagttaattttattcaatttaaagcaatgtctaacctggtgaata |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
T |
45654301 |
attggtgagtattacggtcttaaagttaaacccaagtaatcagtaattcaatgtcaagttaattttattcaatttaaagcaatgtctaacctggtcacta |
45654202 |
T |
 |
Q |
209 |
ttagcctgacaatcaaagtcacaaccacctatgc |
242 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
45654201 |
ttagcttgacaatcaaagtcacaaccacctatgc |
45654168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1292 times since January 2019
Visitors: 3667