View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_high_25 (Length: 243)
Name: NF0548_high_25
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 60 - 190
Target Start/End: Complemental strand, 45654625 - 45654495
Alignment:
| Q |
60 |
aaaaagaatcacattaaatgtttgtgttaatagaaagaaatgagatgaaatcataaaagtttctattgtttaattgattggaaaaaggaatagattccat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654625 |
aaaaagaatcacattaaatgtttgtgttaatagaaagaaatgagatgaaatcataaaagtttctattgtttaattgattggaaaaaggaatagattccat |
45654526 |
T |
|
| Q |
160 |
tcctttctatttgctccttttttctctatca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45654525 |
tcctttctatttgctccttttttctctatca |
45654495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 751 times since January 2019
Visitors: 3656