View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_high_3 (Length: 449)
Name: NF0548_high_3
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 4e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 343 - 443
Target Start/End: Original strand, 2298357 - 2298457
Alignment:
| Q |
343 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaacattttttcatgtgaaagttgcctatgata |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
2298357 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaatattttttcatgtgaaagttgcttatgata |
2298456 |
T |
 |
| Q |
443 |
c |
443 |
Q |
| |
|
| |
|
|
| T |
2298457 |
c |
2298457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University