View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_high_33 (Length: 217)
Name: NF0548_high_33
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 156
Target Start/End: Complemental strand, 45654625 - 45654491
Alignment:
Q |
22 |
aaaaagaatcacattaaatgtttgtgttaatagaaagaaatgagatgaaatcataaaagtttctattgtttaattgattggaaaaaggaatagattccat |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45654625 |
aaaaagaatcacattaaatgtttgtgttaatagaaagaaatgagatgaaatcataaaagtttctattgtttaattgattggaaaaaggaatagattccat |
45654526 |
T |
 |
Q |
122 |
tcctttctatttgctccttttttctctatcatatt |
156 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
45654525 |
tcctttctatttgctccttttttctctatcatatt |
45654491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 589 times since January 2019
Visitors: 3653