View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_high_39 (Length: 203)

Name: NF0548_high_39
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_high_39
NF0548_high_39
[»] chr3 (1 HSPs)
chr3 (23-154)||(45654491-45654622)


Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 23 - 154
Target Start/End: Original strand, 45654491 - 45654622
Alignment:
23 aatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttcatctcatttct 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45654491 aatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttcatctcatttct 45654590  T
123 ttctattaacacaaacatttaatgagattctt 154  Q
    |||||||||||||||||||||||| |||||||    
45654591 ttctattaacacaaacatttaatgtgattctt 45654622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 638 times since January 2019
Visitors: 3655