View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_10 (Length: 427)
Name: NF0548_low_10
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 2e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 72 - 282
Target Start/End: Complemental strand, 6289850 - 6289642
Alignment:
| Q |
72 |
tcgaataatattaagtcaaatggagtgaacatatgaagaagaaagnnnnnnngatgcatatcaaatttcatacgtaccttgagttcgtagcgcctattaa |
171 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6289850 |
tcgaataagattaagtcaaatgaaatgaacatatgaagaaggaaaaaaaaa--atgcacatcaaatttcatacgtaccttgagttcgtagcgcctattaa |
6289753 |
T |
|
| Q |
172 |
agaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggcaaccttggaacaatgtcattgcaataaacaaacctacaataggttat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6289752 |
agaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggcaaccttggaacaatgtcattgcaataaacaaacctgcaataggttat |
6289653 |
T |
|
| Q |
272 |
acgattttcct |
282 |
Q |
| |
|
||||||||||| |
|
|
| T |
6289652 |
acgattttcct |
6289642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 729 times since January 2019
Visitors: 3656