View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_11 (Length: 427)
Name: NF0548_low_11
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 71 - 282
Target Start/End: Complemental strand, 6289851 - 6289642
Alignment:
| Q |
71 |
ctcgaataatattaagtcaaatggagtgaacatatgaagaagaaagnnnnnnngatgcatatcaaatttcatacgtaccttgagttcgtagcgcctatta |
170 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6289851 |
ctcgaataagattaagtcaaatgaaatgaacatatgaagaaggaaaaaaaaa--atgcacatcaaatttcatacgtaccttgagttcgtagcgcctatta |
6289754 |
T |
|
| Q |
171 |
aagaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggcaaccttggaacaatgtcattgcaataaacaaacctacaataggtta |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6289753 |
aagaaaaggcagatcccaaagtgtttgaagagcatatccttatcatcatagggcaaccttggaacaatgtcattgcaataaacaaacctgcaataggtta |
6289654 |
T |
|
| Q |
271 |
tacgattttcct |
282 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6289653 |
tacgattttcct |
6289642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1344 times since January 2019
Visitors: 3667