View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_20 (Length: 363)
Name: NF0548_low_20
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 71 - 264
Target Start/End: Original strand, 43407800 - 43407987
Alignment:
| Q |
71 |
ggaggagcagagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnn |
170 |
Q |
| |
|
|||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407800 |
ggaggatctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtg------ggaggagg |
43407893 |
T |
 |
| Q |
171 |
nnnnnnnnatcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaact |
264 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43407894 |
aggaggagatcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaact |
43407987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University