View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_20 (Length: 363)

Name: NF0548_low_20
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_20
NF0548_low_20
[»] chr5 (1 HSPs)
chr5 (71-264)||(43407800-43407987)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 71 - 264
Target Start/End: Original strand, 43407800 - 43407987
Alignment:
71 ggaggagcagagaaagaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnn 170  Q
    |||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  
43407800 ggaggatctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtg------ggaggagg 43407893  T
171 nnnnnnnnatcaagcagatataattgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaact 264  Q
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||    
43407894 aggaggagatcaagcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaact 43407987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University