View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_25 (Length: 331)
Name: NF0548_low_25
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 29870769 - 29870824
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagat-agggtaaacgtctctgtttctta |
217 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
T |
29870769 |
aattgatttttgcgatgttgattgtggcagataagggtaaacgtctctgcttctta |
29870824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 30481915 - 30481970
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagat-agggtaaacgtctctgtttctta |
217 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
T |
30481915 |
aattgatttttgcgatgttgattgtggcagataagggtaaacgtctctgcttctta |
30481970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 103 - 164
Target Start/End: Original strand, 29851735 - 29851796
Alignment:
Q |
103 |
atgtactctggatctctttctgaggaatgggttccaaagaagtcaacaatgacaatatataa |
164 |
Q |
|
|
|||||| ||||||||||| || |||||||||| |||||||||||||||||| ||||||||| |
|
|
T |
29851735 |
atgtaccctggatctcttcctacggaatgggttacaaagaagtcaacaatgagaatatataa |
29851796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 29870646 - 29870702
Alignment:
Q |
103 |
atgtactctggatctctttctgaggaatgggttccaaagaagtcaacaatgacaata |
159 |
Q |
|
|
|||||||||||||||||| ||| ||||||||||||||||| ||| ||||||| |||| |
|
|
T |
29870646 |
atgtactctggatctcttcctgcggaatgggttccaaagatgtcgacaatgagaata |
29870702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 30243894 - 30243846
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagat-agggtaaacgtctctg |
210 |
Q |
|
|
|||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
T |
30243894 |
aattgatttttgcgatggtgattgaggcagataagggtaaacgtctctg |
30243846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 30340059 - 30340004
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagat-agggtaaacgtctctgtttctta |
217 |
Q |
|
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
T |
30340059 |
aattgaattttgcgatggtgattgaggcagataagggtaaacgtctctgcttctta |
30340004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 217
Target Start/End: Original strand, 30434409 - 30434460
Alignment:
Q |
167 |
gatttttgcgatggtgattgtggcagat-agggtaaacgtctctgtttctta |
217 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
T |
30434409 |
gatttttgcgatggtgattgaggcagataagggtaaacgtctctgcttctta |
30434460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 100
Target Start/End: Complemental strand, 30714790 - 30714756
Alignment:
Q |
66 |
ttatgatgaagaaaattacctgaattagaacaatt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
30714790 |
ttatgatgaagaaaattacctgaattagaacaatt |
30714756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 30058757 - 30058813
Alignment:
Q |
103 |
atgtactctggatctctttctgaggaatgggttccaaagaagtcaacaatgacaata |
159 |
Q |
|
|
|||||||||||||||||| ||| |||||||||||||||| ||| ||||||| |||| |
|
|
T |
30058757 |
atgtactctggatctcttcctgcagaatgggttccaaagatgtcgacaatgagaata |
30058813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 222
Target Start/End: Original strand, 30058880 - 30058940
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagat-agggtaaacgtctctgtttcttataact |
222 |
Q |
|
|
||||||||||||||||||| | || ||||||| |||||||||||||||| |||||| |||| |
|
|
T |
30058880 |
aattgatttttgcgatggttaatgaggcagataagggtaaacgtctctgcttcttaaaact |
30058940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 103 - 151
Target Start/End: Original strand, 30481792 - 30481840
Alignment:
Q |
103 |
atgtactctggatctctttctgaggaatgggttccaaagaagtcaacaa |
151 |
Q |
|
|
||||| |||||||||||| ||| ||||||||||||||| |||||||||| |
|
|
T |
30481792 |
atgtagtctggatctcttcctgcggaatgggttccaaataagtcaacaa |
30481840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 30748226 - 30748281
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagata-gggtaaacgtctctgtttctta |
217 |
Q |
|
|
|||||| ||||||||| ||||||| |||||||| ||||||||||||||| |||||| |
|
|
T |
30748226 |
aattgaattttgcgattgtgattgaggcagataagggtaaacgtctctgcttctta |
30748281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 97
Target Start/End: Original strand, 29870580 - 29870609
Alignment:
Q |
68 |
atgatgaagaaaattacctgaattagaaca |
97 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
29870580 |
atgatgaagaaaattacctgaattagaaca |
29870609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 100
Target Start/End: Complemental strand, 30678987 - 30678954
Alignment:
Q |
67 |
tatgatgaagaaaattacctgaattagaacaatt |
100 |
Q |
|
|
||||||||||||||||||| |||||||||||||| |
|
|
T |
30678987 |
tatgatgaagaaaattaccagaattagaacaatt |
30678954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 67 - 95
Target Start/End: Complemental strand, 30244100 - 30244072
Alignment:
Q |
67 |
tatgatgaagaaaattacctgaattagaa |
95 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
30244100 |
tatgatgaagaaaattacctgaattagaa |
30244072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 67 - 95
Target Start/End: Original strand, 30434201 - 30434229
Alignment:
Q |
67 |
tatgatgaagaaaattacctgaattagaa |
95 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
30434201 |
tatgatgaagaaaattacctgaattagaa |
30434229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 217
Target Start/End: Complemental strand, 30678758 - 30678707
Alignment:
Q |
168 |
atttttgcgatggtgattgtggcagat--agggtaaacgtctctgtttctta |
217 |
Q |
|
|
|||||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
T |
30678758 |
atttttgcgatggtgattaaggcagataaagggtaaacgtctctgcttctta |
30678707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 30714606 - 30714546
Alignment:
Q |
163 |
aattgatttttgcgatggtgattgtggcagata-gggtaaacgtctctgtttcttataact |
222 |
Q |
|
|
|||||||||||| ||||| | || |||||||| ||||||||||||||| ||||||||||| |
|
|
T |
30714606 |
aattgatttttgtgatggctaatgaggcagataagggtaaacgtctctgcttcttataact |
30714546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 159
Target Start/End: Complemental strand, 20298378 - 20298317
Alignment:
Q |
98 |
attttatgtactctggatctctttctgaggaatgggttccaaagaagtcaacaatgacaata |
159 |
Q |
|
|
|||| ||||||||||||||||||||| ||| |||||||||||||||||||| ||| |||| |
|
|
T |
20298378 |
atttcatgtactctggatctctttctacagaacgggttccaaagaagtcaacattgagaata |
20298317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 97
Target Start/End: Complemental strand, 20298434 - 20298405
Alignment:
Q |
68 |
atgatgaagaaaattacctgaattagaaca |
97 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
20298434 |
atgatgaagaaaattacctgaattagaaca |
20298405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 26705848 - 26705892
Alignment:
Q |
167 |
gatttttgcgatggtgattgtggcagat-agggtaaacgtctctg |
210 |
Q |
|
|
|||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
T |
26705848 |
gatttttgtgatggtgattgaggcagataagggtaaacgtctctg |
26705892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 277 times since January 2019
Visitors: 3649