View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_40 (Length: 262)
Name: NF0548_low_40
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 29 - 248
Target Start/End: Complemental strand, 34090834 - 34090615
Alignment:
Q |
29 |
aattacatcattggcatttgggatcacttaacatgttactgatcttcctatatgttgtgtttgtagctttgtggtggtgtggggtggccctcccctagga |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34090834 |
aattacatcattggcatttgggatcacttaacatgttactgatcttcctatatgttgtgtttgtagctttgtggtggtgtggggtggccctcccctagga |
34090735 |
T |
 |
Q |
129 |
ctcttttcatacttagttgtgaggaccactttatactccgtttacacctattaagctttaggttactaccctatactcctaaccctaaccttccaaccat |
228 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34090734 |
ctcttttcatactttgttgtgaggaccactttatactccgtttacacctattaagctttaggttactaccctatactcctaaccctaaccttccaaccat |
34090635 |
T |
 |
Q |
229 |
ctcctacattttcttttgtc |
248 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
34090634 |
ctcctacattttcttttgtc |
34090615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 93
Target Start/End: Original strand, 29262200 - 29262239
Alignment:
Q |
54 |
acttaacatgttactgatcttcctatatgttgtgtttgta |
93 |
Q |
|
|
|||||||||||||||||||| |||||||| |||||||||| |
|
|
T |
29262200 |
acttaacatgttactgatctccctatatgctgtgtttgta |
29262239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University