View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_40 (Length: 262)

Name: NF0548_low_40
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_40
NF0548_low_40
[»] chr2 (1 HSPs)
chr2 (29-248)||(34090615-34090834)
[»] chr1 (1 HSPs)
chr1 (54-93)||(29262200-29262239)


Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 29 - 248
Target Start/End: Complemental strand, 34090834 - 34090615
Alignment:
29 aattacatcattggcatttgggatcacttaacatgttactgatcttcctatatgttgtgtttgtagctttgtggtggtgtggggtggccctcccctagga 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34090834 aattacatcattggcatttgggatcacttaacatgttactgatcttcctatatgttgtgtttgtagctttgtggtggtgtggggtggccctcccctagga 34090735  T
129 ctcttttcatacttagttgtgaggaccactttatactccgtttacacctattaagctttaggttactaccctatactcctaaccctaaccttccaaccat 228  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34090734 ctcttttcatactttgttgtgaggaccactttatactccgtttacacctattaagctttaggttactaccctatactcctaaccctaaccttccaaccat 34090635  T
229 ctcctacattttcttttgtc 248  Q
    ||||||||||||||||||||    
34090634 ctcctacattttcttttgtc 34090615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 93
Target Start/End: Original strand, 29262200 - 29262239
Alignment:
54 acttaacatgttactgatcttcctatatgttgtgtttgta 93  Q
    |||||||||||||||||||| |||||||| ||||||||||    
29262200 acttaacatgttactgatctccctatatgctgtgtttgta 29262239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1751 times since January 2019
Visitors: 3673