View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_41 (Length: 251)

Name: NF0548_low_41
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_41
NF0548_low_41
[»] chr3 (1 HSPs)
chr3 (9-242)||(45654168-45654401)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 45654401 - 45654168
Alignment:
9 attcgaatgaatttagattaaagggatacatttccatgcaaggttcagtctcttttatgcttaactattgaattaggttggatgtttgatttgctaagca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45654401 attcgaatgaatttagattaaagggatacatttccatgcaaggttcagtctcttttatgcttaactattgaattaggttggatgtttgatttgctaagca 45654302  T
109 attggtgagtattacggtcttaaagttaaacccaagtaatcagtaattcaatgtcaagttaattttattcaatttaaagcaatgtctaacctggtgaata 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||    
45654301 attggtgagtattacggtcttaaagttaaacccaagtaatcagtaattcaatgtcaagttaattttattcaatttaaagcaatgtctaacctggtcacta 45654202  T
209 ttagcctgacaatcaaagtcacaaccacctatgc 242  Q
    ||||| ||||||||||||||||||||||||||||    
45654201 ttagcttgacaatcaaagtcacaaccacctatgc 45654168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 455 times since January 2019
Visitors: 3651