View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_45 (Length: 251)
Name: NF0548_low_45
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_low_45 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 6290402 - 6290167
Alignment:
Q |
12 |
aattctaaaataacaactttgcattggcaaattgaagcatgaaattaacatgctttattataagcttattatcgatcgattgacacatattgatacatca |
111 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
6290402 |
aattataaaataacaactttgcattggcaaattgaagcatgaaattaacatgctttattataagcttattatcgat----tgacacatattgatacatca |
6290307 |
T |
 |
Q |
112 |
gtcttctttgaaatgtctttcaatggatccgagaagagttgaattgatataatcttggggaccatgagcaggtaatcctggaattagtaaaccaaccatc |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6290306 |
gtcttctttgaaatgtctttcaatggatccgagaagagttgaattgatataatcttggggaccatgagcaggtaatcctggaattagtaaaccaaccatc |
6290207 |
T |
 |
Q |
212 |
ctaaagaagaagagaaaccatccttctctatagtgaggtc |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6290206 |
ctaaagaagaagagaaaccatccttctctatagtgaggtc |
6290167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1795 times since January 2019
Visitors: 3673