View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_49 (Length: 248)
Name: NF0548_low_49
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 77 - 190
Target Start/End: Complemental strand, 36944956 - 36944846
Alignment:
| Q |
77 |
atagacattcaggtgaacttaactcttatgggtgaagtagtgtttggaaatgaagatgtggttggaatttgacaagaaaaattagtttcatgatgtgatg |
176 |
Q |
| |
|
|||||||||||||||||||||||| | || ||||||| |||||| ||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
36944956 |
atagacattcaggtgaacttaactgcaa-ggatgaagtactgtttgcaaatgaa--tgtggttggaatttgacaagaaaaattagttttatgatttgatg |
36944860 |
T |
|
| Q |
177 |
agacaacatttaag |
190 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36944859 |
agacaacatttaag |
36944846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 77 - 190
Target Start/End: Complemental strand, 36941815 - 36941697
Alignment:
| Q |
77 |
atagacattcaggtgaacttaactcttatgggtgaagtagtgtttggaaatgaag----atgtggttggaatttgacaagaaaaa--ttagtttcatgat |
170 |
Q |
| |
|
||||||||||||||||||||||||| | || ||||||| |||||| ||||||| |||||||| ||||||||||| ||||| ||||||| ||||| |
|
|
| T |
36941815 |
atagacattcaggtgaacttaactccaa-ggatgaagtactgtttgcaaatgaattaatatgtggttagaatttgacaaaaaaaaaattagttttatgat |
36941717 |
T |
|
| Q |
171 |
gtgatgagacaacatttaag |
190 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36941716 |
ttgatgagacaacatttaag |
36941697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1657 times since January 2019
Visitors: 3672