View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_53 (Length: 232)
Name: NF0548_low_53
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 2484120 - 2483900
Alignment:
| Q |
7 |
caaattgcatcacaaccacaccaaacaaaccattctgagtggatcgcaatattttttcttattaccaaaccgcctctcaattaatccaataacttcaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484120 |
caaattgcatcacaaccacaccaaacaagcctttctgagtggatcgtaatattttttcttattaccaaaccgcctctcaattaatccaataacttcaaat |
2484021 |
T |
 |
| Q |
107 |
gcaattgtggtagcaaattccaaattgtatactcaatcaaactctttttatttaaaacgacaactttctcaatccaaatgttgcaagcggtgcctatttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484020 |
gcaattgtggtagcaaattccaaattgtatactcaatcaaactctttttatttaaaacgacaactttctcaatccaaatgttgcaagcggtgcctatttt |
2483921 |
T |
 |
| Q |
207 |
aagaagaaaccaaaattgcaa |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2483920 |
aagaagaaaccaaaattgcaa |
2483900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 58 - 203
Target Start/End: Original strand, 17927479 - 17927621
Alignment:
| Q |
58 |
ttttttcttattaccaaaccgcctctcaattaatccaataacttcaaatgcaattgtggtagcaaattccaaattgtatactcaatcaaactctttttat |
157 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| ||| ||||| |||| | |
|
|
| T |
17927479 |
ttttttcttattaccgatctgcctcttaattaatccaataacttcaaacacaactatggtagcaaattccaaattgtatactcgatccaactcctttttt |
17927578 |
T |
 |
| Q |
158 |
ttaaaacgacaactttctcaatccaaatgttgcaagcggtgcctat |
203 |
Q |
| |
|
|| |||||||| ||||||||||| ||||||||||| |||| |||| |
|
|
| T |
17927579 |
tt--aacgacaattttctcaatcc-aatgttgcaagtggtgtctat |
17927621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University