View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_59 (Length: 218)
Name: NF0548_low_59
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 25 - 169
Target Start/End: Original strand, 45654481 - 45654625
Alignment:
Q |
25 |
catctccaataatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttca |
124 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45654481 |
catctccaaaaatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttca |
45654580 |
T |
 |
Q |
125 |
tctcatttctttctattaacacaaacatttaatgtgattcttttt |
169 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45654581 |
tctcatttctttctattaacacaaacatttaatgtgattcttttt |
45654625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University