View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_6 (Length: 449)

Name: NF0548_low_6
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_6
NF0548_low_6
[»] chr4 (1 HSPs)
chr4 (343-443)||(2298357-2298457)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 4e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 343 - 443
Target Start/End: Original strand, 2298357 - 2298457
Alignment:
343 tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaacattttttcatgtgaaagttgcctatgata 442  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||    
2298357 tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaatattttttcatgtgaaagttgcttatgata 2298456  T
443 c 443  Q
    |    
2298457 c 2298457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 854 times since January 2019
Visitors: 3657