View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_64 (Length: 207)
Name: NF0548_low_64
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0548_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 32274642 - 32274519
Alignment:
Q |
1 |
aacagatttttacttagggcctttaatttgtgactttcttattgtcactgtgataataaaacatatttt-ttcccttctatcttagcatttcataa-ttc |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| |
|
|
T |
32274642 |
aacagatttttacttagggcctttaatttgtgactatcttattgtcactgtgataataaaacagattttaatcccttctatcttagcatttcataatttc |
32274543 |
T |
 |
Q |
99 |
cactttattcttactctatctctg |
122 |
Q |
|
|
||||||||||||||||||| |||| |
|
|
T |
32274542 |
cactttattcttactctatttctg |
32274519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University