View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_64 (Length: 207)

Name: NF0548_low_64
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_64
NF0548_low_64
[»] chr4 (1 HSPs)
chr4 (1-122)||(32274519-32274642)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 32274642 - 32274519
Alignment:
1 aacagatttttacttagggcctttaatttgtgactttcttattgtcactgtgataataaaacatatttt-ttcccttctatcttagcatttcataa-ttc 98  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||| |||    
32274642 aacagatttttacttagggcctttaatttgtgactatcttattgtcactgtgataataaaacagattttaatcccttctatcttagcatttcataatttc 32274543  T
99 cactttattcttactctatctctg 122  Q
    ||||||||||||||||||| ||||    
32274542 cactttattcttactctatttctg 32274519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University