View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_67 (Length: 206)
Name: NF0548_low_67
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 44 - 188
Target Start/End: Original strand, 45654481 - 45654625
Alignment:
| Q |
44 |
catctccaagaatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttca |
143 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654481 |
catctccaaaaatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttca |
45654580 |
T |
|
| Q |
144 |
tctcatttctttctattaacacaaacatttaatgtgattcgtttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45654581 |
tctcatttctttctattaacacaaacatttaatgtgattcttttt |
45654625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 850 times since January 2019
Visitors: 3657