View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0548_low_68 (Length: 203)
Name: NF0548_low_68
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0548_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 23 - 154
Target Start/End: Original strand, 45654491 - 45654622
Alignment:
| Q |
23 |
aatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttcatctcatttct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654491 |
aatatgatagagaaaaaaggagcaaatagaaaggaatggaatctattcctttttccaatcaattaaacaatagaaacttttatgatttcatctcatttct |
45654590 |
T |
|
| Q |
123 |
ttctattaacacaaacatttaatgagattctt |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
45654591 |
ttctattaacacaaacatttaatgtgattctt |
45654622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 561 times since January 2019
Visitors: 3653