View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_high_19 (Length: 391)
Name: NF0549_high_19
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 108 - 291
Target Start/End: Complemental strand, 43231668 - 43231490
Alignment:
Q |
108 |
tatttacttgattcccatgcttaactcttcatcctttacattgacatcttaataaattcgattttgtttgtttaatttgctgaatcgatgtgttggctgg |
207 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
T |
43231668 |
tatttacttgattcccacgcttaactcttcatcctttacattgacatcttaataaattcgattttgtttgttt-----gctgaatcgatgcgttggctgg |
43231574 |
T |
 |
Q |
208 |
ttgtttctgtcgggttgttgattctttaaatactcgtgtattgttcaaggtatgtttgtttggcttttcatttgaagcatttgg |
291 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
43231573 |
ttgtttctgtcgtgttgttgattctttaaatactcgtgtattgttcaaggtatgtttgtttggcttttgatttgaagcatttgg |
43231490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 28 - 61
Target Start/End: Complemental strand, 43231726 - 43231693
Alignment:
Q |
28 |
cactgttgccacactttattctcctcctctcctt |
61 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
43231726 |
cactgttgccacactttattctcctcctctcctt |
43231693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University