View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_high_38 (Length: 256)
Name: NF0549_high_38
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_high_38 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 16331526 - 16331779
Alignment:
Q |
7 |
tcgaataatattactttcggtagaagaattttacgagaaataaatatagaccttttggaccatagaccccccat----gcctttagcactaaaaccaaca |
102 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
T |
16331526 |
tcgaataagattactttcggtagaagaattttacaagaaataaatatagaccttttggaccatagaccacccaaccaagcctttagcactaaaaccaaca |
16331625 |
T |
 |
Q |
103 |
tgtaaacactcctttatttgggtatgagttaaaatttctaacttagtatcattgcctaattatccctaaaaacatgtactacgatccaaacctaagaatc |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
16331626 |
tgtaaacactcctttatttgggtatgagttaaaattactaacttagtatcattgcctaattatccctaaaaacatgtactatgatccaaacctaagaatc |
16331725 |
T |
 |
Q |
203 |
taaaatttaaaaatagggtgtctgattcaacacagaaaaaggtacgtgtaggta |
256 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16331726 |
taaaatttaaaaatagggtgtctgattcaacacagaaaaaggtacgtgtaggta |
16331779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 206 times since January 2019
Visitors: 3675