View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0549_high_44 (Length: 236)

Name: NF0549_high_44
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0549_high_44
NF0549_high_44
[»] chr5 (1 HSPs)
chr5 (25-147)||(2563230-2563352)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 25 - 147
Target Start/End: Original strand, 2563230 - 2563352
Alignment:
25 tatcttggagagtctatgaaaataacttatgaacatgtcataannnnnnnncgaaattattgtaaagctaatattagtagataaattcaaataagtcggt 124  Q
    |||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||| ||||||||    
2563230 tatcttggagagtctatgaaaataacttatgaacatgtcataattttttttcgaaattattgtaaagctaatattagtagataaattcaaaaaagtcggt 2563329  T
125 ctaaacatactctatcatatgat 147  Q
    ||||||||||| |||||||||||    
2563330 ctaaacatactgtatcatatgat 2563352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 94 times since January 2019
Visitors: 3674