View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_high_49 (Length: 211)
Name: NF0549_high_49
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 32714463 - 32714594
Alignment:
| Q |
1 |
tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32714463 |
tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct |
32714562 |
T |
|
| Q |
101 |
ggcacagtaaccgctttctatgtatgtgccta |
132 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
32714563 |
ggcacggtaaccgctttctatgtatgtgccta |
32714594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 32717574 - 32717700
Alignment:
| Q |
1 |
tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct |
100 |
Q |
| |
|
||||||| |||||| | ||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32717574 |
tctaacttctttttgtataggtactggttttcagtccaaaggttcatacttgtttggtcatttcagtatgaacattaagatggttcctggtgattcagct |
32717673 |
T |
|
| Q |
101 |
ggcacagtaaccgctttctatgtatgt |
127 |
Q |
| |
|
|||||||| || ||||||||||||||| |
|
|
| T |
32717674 |
ggcacagtcactgctttctatgtatgt |
32717700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 32708428 - 32708533
Alignment:
| Q |
19 |
aggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaaccgctttc |
118 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||| || || || ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32708428 |
aggtactggtttccaatctaaaggatcatacttgtttggccactttagcatgaacataaagatggttcctggtgattcagctggcacagtcaccgctttt |
32708527 |
T |
|
| Q |
119 |
tatgta |
124 |
Q |
| |
|
|||||| |
|
|
| T |
32708528 |
tatgta |
32708533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 124
Target Start/End: Complemental strand, 10380994 - 10380885
Alignment:
| Q |
15 |
taacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaaccgc |
114 |
Q |
| |
|
||||||||||||| |||||||| ||||| || || || |||||||| || |||||| |||||| ||||| |||||||||||||||| ||||| || || |
|
|
| T |
10380994 |
taacaggtactggctttcaatccaaagggtcttatttatttggtcactttagtatgtacataagaatggtagctggtgattcagctggaacagtcactgc |
10380895 |
T |
|
| Q |
115 |
tttctatgta |
124 |
Q |
| |
|
|||||||||| |
|
|
| T |
10380894 |
tttctatgta |
10380885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 12 - 124
Target Start/End: Original strand, 10409847 - 10409959
Alignment:
| Q |
12 |
ttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaac |
111 |
Q |
| |
|
||||||||||||| || |||||||| ||||| || || || |||||||| || |||||| |||||| ||||| ||||||||||||||||| || || || |
|
|
| T |
10409847 |
ttttaacaggtaccggctttcaatccaaagggtcttatttatttggtcactttagtatgttcataaaaatggtacctggtgattcagctggaactgtcac |
10409946 |
T |
|
| Q |
112 |
cgctttctatgta |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10409947 |
tgctttctatgta |
10409959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 223 times since January 2019
Visitors: 3675