View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0549_high_49 (Length: 211)

Name: NF0549_high_49
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0549_high_49
NF0549_high_49
[»] chr7 (3 HSPs)
chr7 (1-132)||(32714463-32714594)
chr7 (1-127)||(32717574-32717700)
chr7 (19-124)||(32708428-32708533)
[»] chr6 (2 HSPs)
chr6 (15-124)||(10380885-10380994)
chr6 (12-124)||(10409847-10409959)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 32714463 - 32714594
Alignment:
1 tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32714463 tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct 32714562  T
101 ggcacagtaaccgctttctatgtatgtgccta 132  Q
    ||||| ||||||||||||||||||||||||||    
32714563 ggcacggtaaccgctttctatgtatgtgccta 32714594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 32717574 - 32717700
Alignment:
1 tctaactacttttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagct 100  Q
    ||||||| ||||||  | ||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
32717574 tctaacttctttttgtataggtactggttttcagtccaaaggttcatacttgtttggtcatttcagtatgaacattaagatggttcctggtgattcagct 32717673  T
101 ggcacagtaaccgctttctatgtatgt 127  Q
    |||||||| || |||||||||||||||    
32717674 ggcacagtcactgctttctatgtatgt 32717700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 32708428 - 32708533
Alignment:
19 aggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaaccgctttc 118  Q
    |||||||||||| ||||| ||||| |||||||||||||| || || || ||||||||||||||||||||||||||||||||||||||||| ||||||||     
32708428 aggtactggtttccaatctaaaggatcatacttgtttggccactttagcatgaacataaagatggttcctggtgattcagctggcacagtcaccgctttt 32708527  T
119 tatgta 124  Q
    ||||||    
32708528 tatgta 32708533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 124
Target Start/End: Complemental strand, 10380994 - 10380885
Alignment:
15 taacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaaccgc 114  Q
    ||||||||||||| |||||||| ||||| || || || |||||||| || |||||| ||||||  |||||  |||||||||||||||| ||||| || ||    
10380994 taacaggtactggctttcaatccaaagggtcttatttatttggtcactttagtatgtacataagaatggtagctggtgattcagctggaacagtcactgc 10380895  T
115 tttctatgta 124  Q
    ||||||||||    
10380894 tttctatgta 10380885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 12 - 124
Target Start/End: Original strand, 10409847 - 10409959
Alignment:
12 ttttaacaggtactggttttcaatcaaaaggttcatacttgtttggtcatttcagtatgaacataaagatggttcctggtgattcagctggcacagtaac 111  Q
    ||||||||||||| || |||||||| ||||| || || || |||||||| || ||||||  |||||| ||||| ||||||||||||||||| || || ||    
10409847 ttttaacaggtaccggctttcaatccaaagggtcttatttatttggtcactttagtatgttcataaaaatggtacctggtgattcagctggaactgtcac 10409946  T
112 cgctttctatgta 124  Q
     ||||||||||||    
10409947 tgctttctatgta 10409959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University