View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_high_51 (Length: 201)
Name: NF0549_high_51
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 56067918 - 56067869
Alignment:
Q |
1 |
acccacgtttgctatgggaagaagcctttcttgcagtaattctctgctcc |
50 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56067918 |
acccacgtttgctatgggaagaagcctttcttgcagtaattctctgctcc |
56067869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 46 times since January 2019
Visitors: 3673