View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_32 (Length: 360)
Name: NF0549_low_32
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 30 - 268
Target Start/End: Complemental strand, 6122251 - 6122013
Alignment:
Q |
30 |
attatgctgactgattgtttcgttttatttgtaaggaataggctacaataatgtgatgcttgtccattttccctttagggttggttagagcatatattcg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6122251 |
attatgctgactgattgtttcgttttatttgtaaggaataggctacaataatgtgatgcttgtccattttccctttagggttggttagagcatatattcg |
6122152 |
T |
 |
Q |
130 |
atttggataaaataaggaatttactccttagtccctccacttccattattaaaatatatgccccctcccaatgtcatattatctataattagtaaaacaa |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
6122151 |
atttggataaaataaggaatttactccttagtccctccacttccattattaaaatatatgccccctctcaatgtcatattatctataattagtaaaacaa |
6122052 |
T |
 |
Q |
230 |
aatcatattatctatatacatccgttaagcaacttgtac |
268 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6122051 |
aatcatattatctatatacatccgttaagcaacttgtac |
6122013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 641 times since January 2019
Visitors: 3655