View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_40 (Length: 334)
Name: NF0549_low_40
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 134 - 327
Target Start/End: Complemental strand, 33105974 - 33105782
Alignment:
| Q |
134 |
tgaacatctatttctaaattaacaccgatcatatcactttttcataccttacgataaagagggtcgtgaacttctatttccaaaaaccgacgtcatttat |
233 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33105974 |
tgaacttctattttcaaattaacacggatcatatcactttctaataccttacgataaagaga-tcgtgaacttctatttccaaaaaccgacgtcatttgt |
33105876 |
T |
 |
| Q |
234 |
atttagattttcaattattaatctacgatagaccatctatcacagtggaccgccatatagaactttcctatttatagttatatgatattattgg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33105875 |
atttagattttcaattattaatctacgatagaccatctatcacagtggaccgccatatagaactttcctatttatagttatatgatatttttgg |
33105782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University