View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_45 (Length: 320)
Name: NF0549_low_45
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 47804328 - 47804089
Alignment:
Q |
1 |
tttctttttaaatataggaaacaacttgtcatcagggaggaatttcctcttgtctttgggatggtaaagatttttctccttaatgtattcatatatgaga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47804328 |
tttctttttaaatataggaaacaacttgtcatcagggaggaatttcctcttgtctttgggatggtaaagatttttctccttaatgtattcatatatgaga |
47804229 |
T |
 |
Q |
101 |
gatcttattccccattgcatcattggttcggtattgtatctccctatggatgcaaggaagctagatagaggtcttgatgcccatccaacaaattccattg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
47804228 |
gatcttattccccattgcatcattggttcggttttgtatctccctatggatgcaaggaagctagatagaggtcttgatgcccatccgacaaattccattg |
47804129 |
T |
 |
Q |
201 |
aactataccgattctgtttcttcagcttatgcacacctgt |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47804128 |
aactataccgattctgtttcttcagcttatgcacacctgt |
47804089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 47806872 - 47806634
Alignment:
Q |
1 |
tttctttttaaatataggaaacaacttgtcatcagggaggaatttcctcttgtctttgggatggtaaagatttttctccttaatgtattcatatatgaga |
100 |
Q |
|
|
|||||||||||| || ||||||||||| || ||||||| |||||| |||||||||| |||| |||||||||||||| ||||||||||| | |||||| |
|
|
T |
47806872 |
tttctttttaaagattggaaacaacttatcgtcagggaagaattttttcttgtctttatgatgataaagatttttctctgtaatgtattcaaacatgaga |
47806773 |
T |
 |
Q |
101 |
gatcttattccccattgcatcattggttcggtattgtatctccctatggatgcaaggaagctagatagaggtcttgatgcccatccaacaaattccattg |
200 |
Q |
|
|
||| ||| ||| | |||||||||||||||| | ||||||||||||||||| ||||| ||||| ||||||| ||||||||||||||| |||||| || |
|
|
T |
47806772 |
gattttacatcccttcgcatcattggttcggtttcatatctccctatggatgccaggaaactagagagaggtcctgatgcccatccaacgaattcccctg |
47806673 |
T |
 |
Q |
201 |
aactataccgattctgtttcttcagcttatgcacacctg |
239 |
Q |
|
|
||||||| || ||| |||| ||| ||||||||| ||||| |
|
|
T |
47806672 |
aactatagcgcttccgtttgttcggcttatgcatacctg |
47806634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 248 times since January 2019
Visitors: 3675