View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_46 (Length: 318)
Name: NF0549_low_46
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 97 - 294
Target Start/End: Complemental strand, 47456166 - 47455969
Alignment:
| Q |
97 |
catctatacttgtattggcttcttctgccttgttctcatttctattaaccttcttgctcttcttggactctgcattatttacgtatctttgcacctgaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47456166 |
catctatacttgtattggcttcttctgccttgttctcatttctattaaccttcttgctcttcttggactctgcattatttacgtatctttgcacctgaat |
47456067 |
T |
|
| Q |
197 |
ttcgaaaccacgagcacaaaccgttacaaactcacaaaatgtcaaattattgttattaattattaaagtgacactaataatcattttatattcatctc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47456066 |
ttcgaaaccacgagcacaaaccgttacaaactcacaaaatgtcaaattattgttattaattattaaagtgacactaataatcattttatatccatctc |
47455969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University