View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_51 (Length: 313)
Name: NF0549_low_51
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 286
Target Start/End: Original strand, 8642679 - 8642953
Alignment:
| Q |
10 |
aataatattgatagaaacataagactgcaaaaggattcatctaannnnnnnnnnggataaatcaagatgtttttcacacgtatttgtgaagactaatttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8642679 |
aataatattgatagaaacataagactgcaaaaggattcatctaatttttttt--gggtaaatcaagatgtttttcacacatatttctgaagactaatttc |
8642776 |
T |
|
| Q |
110 |
ttgaaataattgagattcattttaattgaaatattttaaaacacattgttttagacacagtcacgtaattaagaattcgtgttggtatgcggtataggtt |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
8642777 |
ttgaagtaattgagattcattttaattgaaatattttaaaacacattgttttagacacagtcacgtaattaacaattcatgttggtatgcggtataggtt |
8642876 |
T |
|
| Q |
210 |
tgcggtacgcgacatgagacgaattcttatcatcttagcgatgtgtctaaaacatatttaaggaacccaactatttg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8642877 |
tgcggtacgcgacatgagacgaattcttatcatcttagcgatgtgtctaaaacatatttaaagaatccaactatttg |
8642953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1590 times since January 2019
Visitors: 3672