View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_52 (Length: 313)
Name: NF0549_low_52
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 286
Target Start/End: Original strand, 8642682 - 8642953
Alignment:
| Q |
13 |
aatattgatagaaacataagactgcaaaaggattcatctaannnnnnnnnnggataaatcaagatgtttttcacacgtatttgtgaagactaatttcttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
8642682 |
aatattgatagaaacataagactgcaaaaggattcatctaatttttttt--gggtaaatcaagatgtttttcacacatatttctgaagactaatttcttg |
8642779 |
T |
|
| Q |
113 |
aaataattgagattcattttaattgaaatattttaaaacacattgttttagacacagtcacgtaattaagaattcgtgttggtatgcggtataggtttgc |
212 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
8642780 |
aagtaattgagattcattttaattgaaatattttaaaacacattgttttagacacagtcacgtaattaacaattcatgttggtatgcggtataggtttgc |
8642879 |
T |
|
| Q |
213 |
ggtacgcgacatgagacgaattcttatcatcttagcgatgtgtctaaaacatatttaaggaacccaactatttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8642880 |
ggtacgcgacatgagacgaattcttatcatcttagcgatgtgtctaaaacatatttaaagaatccaactatttg |
8642953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1736 times since January 2019
Visitors: 3673