View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_54 (Length: 310)
Name: NF0549_low_54
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 278
Target Start/End: Original strand, 43383683 - 43383943
Alignment:
| Q |
30 |
aattctactactggaaggacattcatgacgcctcacgatgacacaatgactcgtggtggaaacgtgg------aaggggaagcggttaataataatgaga |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43383683 |
aattctactactggaaggacgttcatgacgcctcacgatgacacaatgactcgtggtggaaacgtggaagtggaaggggaagcggttaataataatgaga |
43383782 |
T |
|
| Q |
124 |
tgataaactgcatcatcggacacaagtgtagcatatgtttgagggtatttagcactggacaagcactcggtggtcataagaggtgtcattgggaaaaagt |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383783 |
tgattaactgcatcatcggacacaagtgtagcatatgtttgagggtatttagcactggacaagcactcggtggtcataagaggtgtcattgggaaaaagt |
43383882 |
T |
|
| Q |
224 |
ggaaccca------caacaccaacaccaacactaccatttgatttgaatttcccttttcca |
278 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383883 |
ggaacccaaaacaccaacaccaacaccaacactaccatttgatttgaatttcccttttcca |
43383943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 85 - 278
Target Start/End: Original strand, 25870423 - 25870613
Alignment:
| Q |
85 |
gtggaaacgtggaaggggaagcggttaataataatgaga-tgataa--actgcatcatcggacacaagtgtagcatatgtttgagggtatttagcactgg |
181 |
Q |
| |
|
|||||||||| |||||||||| |||||||| |||| | | | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870423 |
gtggaaacgttgaaggggaagaggttaatagtaataataataataatgactgcatcatcggacacaagtgtagcatatgtttgagggtatttagcactgg |
25870522 |
T |
|
| Q |
182 |
acaagcactcggtggtcataagaggtgtcattgggaaaaagtggaacccacaacaccaacaccaacactaccatttgatttgaatttcccttttcca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870523 |
acaagcactcggtggtcataagaggtgtcattgggataaaggggaaccca------cgacaccaacactaccatttgatttgaatttcccttttcca |
25870613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1497 times since January 2019
Visitors: 3669