View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_55 (Length: 302)
Name: NF0549_low_55
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_55 |
 |  |
|
| [»] scaffold0042 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 60 - 235
Target Start/End: Original strand, 26373552 - 26373728
Alignment:
| Q |
60 |
agcacagaccatcaacacaaccagtttcagacgtgtctgaacccagatcatgggatgagtccaacacacgttagtaaccaaacagcccttaccggtttaa |
159 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26373552 |
agcacagaccaccaacacaaccagtttcagacgtgtctgaacccagattatgggatgagtccaacacacgttagtaaccaaacagcccttacgggtttaa |
26373651 |
T |
 |
| Q |
160 |
agaaccaattcctttcgggtttgcgaaacagaa-catcaaaacaggtcacaactgttaccatgccctccaatctctg |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26373652 |
agaaccataccctttcgggtttgcgaaacagaaccaccaaaacaggtcacaactgttaccatgccctccaatctctg |
26373728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 126
Target Start/End: Original strand, 28541701 - 28541750
Alignment:
| Q |
77 |
caaccagtttcagacgtgtctgaacccagatcatgggatgagtccaacac |
126 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||| |||||| |
|
|
| T |
28541701 |
caaccagtttcagacgtgtttgaacccatatcgagggatgagttcaacac |
28541750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 60 - 235
Target Start/End: Complemental strand, 31055 - 30879
Alignment:
| Q |
60 |
agcacagaccatcaacacaaccagtttcagacgtgtctgaacccagatcatgggatgagtccaacacacgttagtaaccaaacagcccttaccggtttaa |
159 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
31055 |
agcacaaaccaccaacacaaccagtttcagacgtgtctgaactcagatcatgggatgagtctaacacacgttagtaaccaaacaacccttataggtttaa |
30956 |
T |
 |
| Q |
160 |
agaaccaattcctttcgggtttgcgaaacagaa-catcaaaacaggtcacaactgttaccatgccctccaatctctg |
235 |
Q |
| |
|
||||||| |||||||||||||||||||| || || ||||||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
30955 |
agaaccataccctttcgggtttgcgaaacaaaaccaccaaaacatgtcacaattgttaccatgtcctccaatctctg |
30879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 166
Target Start/End: Complemental strand, 44742107 - 44742001
Alignment:
| Q |
60 |
agcacagaccatcaacacaaccagtttcagacgtgtctgaacccagatcatgggatgagtccaacacacgttagtaaccaaacagcccttaccggtttaa |
159 |
Q |
| |
|
||||| ||||| |||||||| | ||| |||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
44742107 |
agcacggaccaccaacacaaacggttccagacgcgcttgaacccagatcaagggatgagtccaacacacgttagtaaccaaacagcccttacgggttaaa |
44742008 |
T |
 |
| Q |
160 |
agaacca |
166 |
Q |
| |
|
||||||| |
|
|
| T |
44742007 |
agaacca |
44742001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 65 - 167
Target Start/End: Original strand, 14635958 - 14636057
Alignment:
| Q |
65 |
agaccatcaacacaaccagtttcagacgtgtctgaacccagatcatgggatgagtccaacacacgttagtaaccaaacagcccttaccggtttaaagaac |
164 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||||||||||| ||||||||| || |||||||||| ||| |||||||||| | |||||| ||||| |
|
|
| T |
14635958 |
agaccaccaactcaaccagtttcagacgtgtttgaacccagatcaagggatgagttca--acacgttagttacc-aacagccctttcgggtttatagaac |
14636054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University