View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_56 (Length: 299)
Name: NF0549_low_56
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 57 - 172
Target Start/End: Original strand, 34331491 - 34331606
Alignment:
Q |
57 |
ggagcagagataacaaatcaattgatagacaagcaaaccattttgggaaacacccaaactgggtcaaaatcgtagacaacaagtgaaagaccaaatggta |
156 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34331491 |
ggagcaaagataacaaatcaattgatagacaagcaaaccattttgggaaacacctaaactgggtcaaaatcgtagacaacaagtgaaagaccaaatggta |
34331590 |
T |
 |
Q |
157 |
gattttgacaagatac |
172 |
Q |
|
|
|||||||||||||||| |
|
|
T |
34331591 |
gattttgacaagatac |
34331606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University