View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_57 (Length: 299)
Name: NF0549_low_57
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 64 - 222
Target Start/End: Original strand, 15114298 - 15114456
Alignment:
| Q |
64 |
atgacgaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaa |
163 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15114298 |
atgacgaggaatgatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaa |
15114397 |
T |
 |
| Q |
164 |
gaggacatggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15114398 |
gaggacatggaggcatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
15114456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 64 - 220
Target Start/End: Complemental strand, 15445246 - 15445090
Alignment:
| Q |
64 |
atgacgaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||| |||| |
|
|
| T |
15445246 |
atgacgaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaacaggcttctggatagtttttggttctcttttattcaa |
15445147 |
T |
 |
| Q |
164 |
gaggacatggagggatgcttacttcaattttctttatgatgtcaaagattggcttat |
220 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
15445146 |
gaggtcatggaggcatgcttacttcaattttctttatgatgtcaaagactggtttat |
15445090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 64 - 222
Target Start/End: Complemental strand, 15301498 - 15301340
Alignment:
| Q |
64 |
atgacgaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaa |
163 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||| |||| ||||| ||||||||| | |||||| | || |
|
|
| T |
15301498 |
atgatgaggaaggatccgagctaatggaatgtttctatatgggcatggcagttggattttcaacatgcttctggatagtttttggtacccttttatttaa |
15301399 |
T |
 |
| Q |
164 |
gaggacatggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
15301398 |
gaggacatggaggcatgcttacttcaattttctttatgatgtcaaagactggtttatgt |
15301340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 64 - 222
Target Start/End: Complemental strand, 15481867 - 15481709
Alignment:
| Q |
64 |
atgacgaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaa |
163 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||| |||| ||||| ||||||||| | |||||| | || |
|
|
| T |
15481867 |
atgatgaggaaggatccgagctaatggaatgtttctatatgggcatggcagttggattttcaacatgcttctggatagtttttggtacccttttatttaa |
15481768 |
T |
 |
| Q |
164 |
gaggacatggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
15481767 |
gaggacatggaggcatgcttacttcaattttctttatgatgtcaaagactggtttatgt |
15481709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 15282972 - 15282819
Alignment:
| Q |
69 |
gaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagagga |
168 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||| |||| ||||| ||||||||| | |||||| | ||||||| |
|
|
| T |
15282972 |
gaggaaggatctgagctaatggaatgtttctatatgggcatgggagttggatttacaacaggcttctggatagtttttggtacccttttatttaagagga |
15282873 |
T |
 |
| Q |
169 |
catggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
15282872 |
catggaggcatgcttacttcaattttctttatgatgtgaaagactggtttatgt |
15282819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 15312346 - 15312193
Alignment:
| Q |
69 |
gaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagagga |
168 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| ||| | |||||||||||||||||| |||||||| |
|
|
| T |
15312346 |
gaggaaggatccgagctaatggaatgtttctatatgggtatgggagttggatttgcaacaggcttctgggtagtttttggttctcttttattcaagaggt |
15312247 |
T |
 |
| Q |
169 |
catggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| ||||| ||| |||||| |
|
|
| T |
15312246 |
catggagacatgcttacttcaatttcctttatgatgtgaaagactggtttatgt |
15312193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 15463341 - 15463188
Alignment:
| Q |
69 |
gaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagagga |
168 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||| |||| ||||| ||||||||| | |||||| | ||||||| |
|
|
| T |
15463341 |
gaggaaggatctgagctaatggaatgtttctatatgggcatgggagttggatttacaacaggcttctggatagtttttggtacccttttatttaagagga |
15463242 |
T |
 |
| Q |
169 |
catggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
15463241 |
catggaggcatgcttacttcaattttctttatgatgtgaaagactggtttatgt |
15463188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 15492715 - 15492562
Alignment:
| Q |
69 |
gaggaaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagagga |
168 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| ||| | |||||||||||||||||| |||||||| |
|
|
| T |
15492715 |
gaggaaggatccgagctaatggaatgtttctatatgggtatgggagttggatttgcaacaggcttctgggtagtttttggttctcttttattcaagaggt |
15492616 |
T |
 |
| Q |
169 |
catggagggatgcttacttcaattttctttatgatgtcaaagattggcttatgt |
222 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| ||||| ||| |||||| |
|
|
| T |
15492615 |
catggagacatgcttacttcaatttcctttatgatgtgaaagactggtttatgt |
15492562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 73 - 211
Target Start/End: Complemental strand, 15280350 - 15280216
Alignment:
| Q |
73 |
aaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagaggacatg |
172 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||| |||| ||| |||| |
|
|
| T |
15280350 |
aaggatctgagctaatggaatgtttctatatgggcatgggagttggatttgcaacaggctt----ctagtttttggttctcttttattcaacaggtcatg |
15280255 |
T |
 |
| Q |
173 |
gagggatgcttacttcaattttctttatgatgtcaaaga |
211 |
Q |
| |
|
|| | ||||||||||||||||| | |||||||| ||||| |
|
|
| T |
15280254 |
gaagcatgcttacttcaattttttatatgatgtgaaaga |
15280216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 73 - 211
Target Start/End: Complemental strand, 15460719 - 15460585
Alignment:
| Q |
73 |
aaggatccgagttaatggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagaggacatg |
172 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||| |||| ||| |||| |
|
|
| T |
15460719 |
aaggatctgagctaatggaatgtttctatatgggcatgggagttggatttgcaacaggctt----ctagtttttggttctcttttattcaacaggtcatg |
15460624 |
T |
 |
| Q |
173 |
gagggatgcttacttcaattttctttatgatgtcaaaga |
211 |
Q |
| |
|
|| | ||||||||||||||||| | |||||||| ||||| |
|
|
| T |
15460623 |
gaagcatgcttacttcaattttttatatgatgtgaaaga |
15460585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 88 - 204
Target Start/End: Complemental strand, 18050956 - 18050840
Alignment:
| Q |
88 |
tggaatgtttctatatgggcatgggagttggatttgcaatcagcttttggattgtttttggttctcttttactcaagaggacatggagggatgcttactt |
187 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||| |||| | ||||||||| | |||||| |
|
|
| T |
18050956 |
tggaatggttttatatgggcatgggagttggatttgcaatcagcttcttgattgttttttgttctcttttattcaatcgaacatggaggcacaattactt |
18050857 |
T |
 |
| Q |
188 |
caattttctttatgatg |
204 |
Q |
| |
|
||| |||||| |||||| |
|
|
| T |
18050856 |
caaatttcttgatgatg |
18050840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University