View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_60 (Length: 292)
Name: NF0549_low_60
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 42 - 241
Target Start/End: Complemental strand, 43918915 - 43918716
Alignment:
| Q |
42 |
tcagtttattcaaggaagatttcttaccatccttcctttggtatcccttctttgtcatgaagtcacaatctgcctcatgatctgtaaccctgacattggt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918915 |
tcagtttattcaaggaagatttcttaccatccttcctttggtatcccttctttgtcatgaagtcacaatctgcctcatgatctgtaaccctgacattggt |
43918816 |
T |
|
| Q |
142 |
taaatatcataatcttattcaacatggcaaacttgagagcaaaaatattgcaaagagcttcatataaaagcgtagtttaaatgacttatttacatctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43918815 |
taaatatcataatcttattcaacatggcaaacttgagagcaaaaatattgcaaagagcttcatataaaagcgtagtttaaatgatttatttacatctctg |
43918716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1464 times since January 2019
Visitors: 3669