View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_61 (Length: 292)
Name: NF0549_low_61
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_61 |
 | |
|
| [»] scaffold0136 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0136 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 50 - 242
Target Start/End: Complemental strand, 31751 - 31559
Alignment:
| Q |
50 |
cagagagggggtggagggatctcatattccagaggattcgatctgtgtttggttttggaatgtgagatttcattgaaagtatgtgttgtggaattcgann |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31751 |
cagagagggggtggagggatctcatattccagaggattcgatctgtgtttggttttggaatgtgagatttcattgaaagtatgtgttgtagaattcgatt |
31652 |
T |
|
| Q |
150 |
nnnnnnnnnnnnnnatatggttagatcattggattggcattggatcattttattgtgaaagacgaagtgtcttttgcaatgatctctgctgct |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31651 |
tttgttttctttttatatggttagatcattttattggcattggatcattttattgtgaaagacgaagtgtcttttgcaatgatttctgctgct |
31559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 828 times since January 2019
Visitors: 3657