View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_63 (Length: 289)
Name: NF0549_low_63
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0549_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 56 - 230
Target Start/End: Complemental strand, 37366663 - 37366487
Alignment:
Q |
56 |
cttgtctagagtctacaacactggtgtgcagacaaaagtcataacataaactat--tgtgcaacttctataaatccatttacaatatggttgaagttgtg |
153 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37366663 |
cttgtctagagtctacaacattggtgtgcagacaaaagtcataacataaactatattgtgcaacttctataaatccatttacaatatggttgaagttgtg |
37366564 |
T |
 |
Q |
154 |
atacattggctctgacttgcttgaattatgtgcgttaggttttgatgaagctatttagaattagttttgatgtgtat |
230 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37366563 |
atacattggctctgacttggttgaattatgtgcgttaggttttgatgaagctatttagaattagttttgatgtgtat |
37366487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University