View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0549_low_65 (Length: 279)
Name: NF0549_low_65
Description: NF0549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0549_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 272
Target Start/End: Original strand, 7353511 - 7353753
Alignment:
| Q |
30 |
gacctcctcctcttgttcgccttactgtcgttaatgcctcttcatccactgaaaatgaccaaaacatggagaccccattttcaataggtccatgtggtga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353511 |
gacctcctcctcttgttcgccttactgtcgttaatgcctcttcatccactgaaaatgaccaaaacatggagaccccattttcaataggtccatgtggtga |
7353610 |
T |
|
| Q |
130 |
tactttctcttctggactccttggttatgctcagtccttaaatgtcaatctgcagataaaaaagcttgataatcatccattgcagacattgaatgctaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353611 |
tactttctcttctggactccttggttatgctcagtccttaaatgtcaatctgcagataaaaaagcttgataatcatccattgcagacattgaatgctaaa |
7353710 |
T |
|
| Q |
230 |
agtgttgacacatcctctgatgaaacccttattgtctgtgctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353711 |
agtgttgacacatcctctgatgaaacccttattgtctgtgctc |
7353753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1466 times since January 2019
Visitors: 3669